Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1295
Clone ID E1295
Template ID T1295
Template Origin Plasmid
Clone Image 2236312
Validity OK
Gene symbol Rnf25
Gene description ring finger protein 25 (Rnf25)
Gene Aliases AO7, 0610009H16Rik
MGI ID MGI:1890215
Entrez Gene ID 57751
Ref Seq Accession NM_021313
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000027357
ENSEMBL Gene ID ENSMUSG00000026171
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 14
Template Well F10
Template Group  
Template Sequence Status Partial
Template Sequence ID 2236312_r1AW106738BX
TGU B
 Template Sequence