Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T129
Clone ID E129
Template ID T129
Template Origin Plasmid
Clone Image 2581948
Validity OK
Gene symbol Sestd1
Gene description SEC14 and spectrin domains 1 (Sestd1)
Gene Aliases MGC51459, A930010O20, 1500031J16Rik
MGI ID MGI:1916262
Entrez Gene ID 228071
Ref Seq Accession NM_175465
Chromosome Location 2
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 2
Template Well D12
Template Group  
Template Sequence Status Partial
Template Sequence ID 2581948_r1AW213033BX
TGU M
 Template Sequence