Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1276
Clone ID E1276
Template ID T1276
Template Origin Plasmid
Clone Image 2225745
Validity OK
Gene symbol 1200014J11Rik
Gene description RIKEN cDNA 1200014J11 gene (1200014J11Rik)
Gene Aliases  
MGI ID MGI:1914124
Entrez Gene ID 66874
Ref Seq Accession NM_025818
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000021135
ENSEMBL Gene ID ENSMUSG00000020783
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 14
Template Well E03
Template Group  
Template Sequence Status Partial
Template Sequence ID 2225745_r1AW106385BX
TGU B
 Template Sequence