Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1272
Clone ID E1272
Template ID T1272
Template Origin Plasmid
Clone Image 2225700
Validity OK
Gene symbol 2610319K07Rik
Gene description RIKEN cDNA 2610319K07 gene (2610319K07Rik)
Gene Aliases  
MGI ID MGI:1919769
Entrez Gene ID 72519
Ref Seq Accession NM_028264
Chromosome Location 4
ENSEMBL Transcript ID ENSMUST00000029875
ENSEMBL Gene ID ENSMUSG00000028221
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 14
Template Well D11
Template Group  
Template Sequence Status Partial
Template Sequence ID 2225700_r1AW106347BX
TGU B
 Template Sequence