Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1268
Clone ID E1268
Template ID T1268
Template Origin Plasmid
Clone Image 2225645
Validity OK
Gene symbol Krt2-4
Gene description keratin complex 2, basic, gene 4 (Krt2-4)
Gene Aliases Krt-2.4
MGI ID MGI:96701
Entrez Gene ID 16682
Ref Seq Accession NM_008475
Chromosome Location 15
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 14
Template Well D07
Template Group  
Template Sequence Status Partial
Template Sequence ID 2225645_r1AW106316BX
TGU B
 Template Sequence