Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1252
Clone ID E1252
Template ID T1252
Template Origin Plasmid
Clone Image 2225370
Validity OK
Gene symbol 1500011K16Rik
Gene description RIKEN cDNA 1500011K16 gene (1500011K16Rik)
Gene Aliases  
MGI ID MGI:1915135
Entrez Gene ID 67885
Ref Seq Accession NM_175125
Chromosome Location 2
ENSEMBL Transcript ID ENSMUST00000057459
ENSEMBL Gene ID ENSMUSG00000051319
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 14
Template Well C03
Template Group  
Template Sequence Status Partial
Template Sequence ID 2225370_r1AW106096BX
TGU B
 Template Sequence