Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1224
Clone ID E1224
Template ID T1224
Template Origin Plasmid
Clone Image 2192576
Validity OK
Gene symbol 5830468K18Rik
Gene description RIKEN cDNA 5830468K18 gene (5830468K18Rik)
Gene Aliases MGC99963, 5830468K18Rik
MGI ID MGI:2442510
Entrez Gene ID 226539
Ref Seq Accession NM_172644
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000035430
ENSEMBL Gene ID ENSMUSG00000026709
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 13
Template Well H11
Template Group  
Template Sequence Status Partial
Template Sequence ID 2192576_r1AW045081BX
TGU B
 Template Sequence