Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1223
Clone ID E1223
Template ID T1223
Template Origin Plasmid
Clone Image 2192575
Validity OK
Gene symbol Fundc1
Gene description FUN14 domain containing 1 (Fundc1)
Gene Aliases 1500005J14Rik, 1810033P05Rik
MGI ID MGI:1919268
Entrez Gene ID 72018
Ref Seq Accession NM_028058
Chromosome Location X
ENSEMBL Transcript ID ENSMUST00000026016
ENSEMBL Gene ID ENSMUSG00000025040
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 13
Template Well H10
Template Group  
Template Sequence Status Partial
Template Sequence ID 2192575_r1AW045091BX
TGU B
 Template Sequence