Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1220
Clone ID E1220
Template ID T1220
Template Origin Plasmid
Clone Image 2192562
Validity OK
Gene symbol Nek4
Gene description NIMA (never in mitosis gene a)-related expressed kinase 4 (Nek4)
Gene Aliases  
MGI ID MGI:1344404
Entrez Gene ID 23955
Ref Seq Accession NM_011849
Chromosome Location 14
ENSEMBL Transcript ID ENSMUST00000022482
ENSEMBL Gene ID ENSMUSG00000021918
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 13
Template Well H07
Template Group  
Template Sequence Status Partial
Template Sequence ID 2192562_r1AW045065BX
TGU B
 Template Sequence