Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1219
Clone ID E1219
Template ID T1219
Template Origin Plasmid
Clone Image 2192555
Validity OK
Gene symbol Mrpl50
Gene description mitochondrial ribosomal protein L50 (Mrpl50)
Gene Aliases D4Wsu125e
MGI ID MGI:107329
Entrez Gene ID 28028
Ref Seq Accession NM_178603
Chromosome Location 4
ENSEMBL Transcript ID ENSMUST00000057829
ENSEMBL Gene ID ENSMUSG00000044018
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 13
Template Well H06
Template Group  
Template Sequence Status Partial
Template Sequence ID 2192555_r1AW045071BX
TGU B
 Template Sequence