Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1201
Clone ID E1201
Template ID T1201
Template Origin Plasmid
Clone Image 2182416
Validity OK
Gene symbol Gfm2
Gene description G elongation factor, mitochondrial 2 (Gfm2)
Gene Aliases EFG2, MST027, A930009M04Rik
MGI ID MGI:2444783
Entrez Gene ID 320806
Ref Seq Accession NM_177266
Chromosome Location 13
ENSEMBL Transcript ID ENSMUST00000022170
ENSEMBL Gene ID ENSMUSG00000021666
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 13
Template Well F12
Template Group  
Template Sequence Status Partial
Template Sequence ID 2182416_r1BX520678AI
TGU B
 Template Sequence