Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1199
Clone ID E1199
Template ID T1199
Template Origin Plasmid
Clone Image 2182368
Validity OK
Gene symbol Vapb
Gene description vesicle-associated membrane protein, associated protein B and C (Vapb)
Gene Aliases VAP33b, D2Abb2e, Vamp33b
MGI ID MGI:1928744
Entrez Gene ID 56491
Ref Seq Accession NM_019806
Chromosome Location 2
ENSEMBL Transcript ID ENSMUST00000029026
ENSEMBL Gene ID ENSMUSG00000027521
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 13
Template Well F10
Template Group  
Template Sequence Status Partial
Template Sequence ID 2182368_r1AW012303BX
TGU B
 Template Sequence