Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1179
Clone ID E1179
Template ID T1179
Template Origin Plasmid
Clone Image 2159441
Validity OK
Gene symbol Sptlc2
Gene description serine palmitoyltransferase, long chain base subunit 2 (Sptlc2)
Gene Aliases LCB2, mKIAA0526
MGI ID MGI:108074
Entrez Gene ID 20773
Ref Seq Accession NM_011479
Chromosome Location 12
ENSEMBL Transcript ID ENSMUST00000021424
ENSEMBL Gene ID ENSMUSG00000021036
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 13
Template Well E02
Template Group  
Template Sequence Status Partial
Template Sequence ID 2159441_r1AW107564BX
TGU B
 Template Sequence