Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1175
Clone ID E1175
Template ID T1175
Template Origin Plasmid
Clone Image 2159163
Validity OK
Gene symbol Smc6l1
Gene description SMC6 structural maintenance of chromosomes 6-like 1 (yeast) (Smc6l1)
Gene Aliases KIA, MGC, SMC6, mKIAA4103, 2810489L22Rik, 3830418C19Rik
MGI ID MGI:1914491
Entrez Gene ID 67241
Ref Seq Accession NM_025695
Chromosome Location 12
ENSEMBL Transcript ID ENSMUST00000051716
ENSEMBL Gene ID ENSMUSG00000020608
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 13
Template Well D10
Template Group  
Template Sequence Status Partial
Template Sequence ID 2159163_r1AW012229BX
TGU B
 Template Sequence