Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1132
Clone ID E1132
Template ID T1132
Template Origin Plasmid
Clone Image 2135642
Validity OK
Gene symbol Adm
Gene description adrenomedullin (Adm)
Gene Aliases AM
MGI ID MGI:108058
Entrez Gene ID 11535
Ref Seq Accession NM_009627
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000033054
ENSEMBL Gene ID ENSMUSG00000030790
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 13
Template Well A03
Template Group  
Template Sequence Status Partial
Template Sequence ID 2135642_r1AI931303BX
TGU B
 Template Sequence