Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1131
Clone ID E1131
Template ID T1131
Template Origin Plasmid
Clone Image 2135621
Validity OK
Gene symbol Tspan12
Gene description tetraspanin 12 (Tspan12)
Gene Aliases Tm4sf12, 9030619E17
MGI ID MGI:1889818
Entrez Gene ID 269831
Ref Seq Accession NM_173007
Chromosome Location 6
ENSEMBL Transcript ID ENSMUST00000031678
ENSEMBL Gene ID ENSMUSG00000029669
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 13
Template Well A02
Template Group  
Template Sequence Status Partial
Template Sequence ID 2135621_r1AI931294BX
TGU B
 Template Sequence