Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1125
Clone ID E1125
Template ID T1125
Template Origin Plasmid
Clone Image 2135522
Validity OK
Gene symbol Azgp1
Gene description alpha-2-glycoprotein 1, zinc (Azgp1)
Gene Aliases  
MGI ID MGI:103163
Entrez Gene ID 12007
Ref Seq Accession NM_013478
Chromosome Location 5
ENSEMBL Transcript ID ENSMUST00000035390
ENSEMBL Gene ID ENSMUSG00000037053
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 12
Template Well H08
Template Group  
Template Sequence Status Partial
Template Sequence ID 2135522_r1AI930554BX
TGU B
 Template Sequence