Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1085
Clone ID E1085
Template ID T1085
Template Origin Plasmid
Clone Image 2123019
Validity OK
Gene symbol Oaz2
Gene description ornithine decarboxylase antizyme 2 (Oaz2)
Gene Aliases AZ-2, Sez15
MGI ID MGI:109492
Entrez Gene ID 18247
Ref Seq Accession NM_010952
Chromosome Location 9
ENSEMBL Transcript ID ENSMUST00000046490
ENSEMBL Gene ID ENSMUSG00000040652
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 12
Template Well E04
Template Group  
Template Sequence Status Partial
Template Sequence ID 2123019_r1AI882237BX
TGU B
 Template Sequence