Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1077
Clone ID E1077
Template ID T1077
Template Origin Plasmid
Clone Image 2099872
Validity OK
Gene symbol 5330420D20Rik
Gene description RIKEN cDNA 5330420D20 gene (5330420D20Rik)
Gene Aliases Ddo, 5730402C02Rik
MGI ID MGI:1925528
Entrez Gene ID 70503
Ref Seq Accession NM_027442
Chromosome Location 10
ENSEMBL Transcript ID ENSMUST00000019977
ENSEMBL Gene ID ENSMUSG00000063428
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 12
Template Well D08
Template Group  
Template Sequence Status Partial
Template Sequence ID 2099872_r1AI882123BX
TGU B
 Template Sequence