Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1054
Clone ID E1054
Template ID T1054
Template Origin Plasmid
Clone Image 2088410
Validity OK
Gene symbol Eya3
Gene description eyes absent 3 homolog (Drosophila) (Eya3), transcript variant 1
Gene Aliases  
MGI ID MGI:109339
Entrez Gene ID 14050
Ref Seq Accession NM_210071
Chromosome Location 4
ENSEMBL Transcript ID ENSMUST00000081726
ENSEMBL Gene ID ENSMUSG00000028886
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 12
Template Well B09
Template Group  
Template Sequence Status Partial
Template Sequence ID 2088410_r1AI787798BX
TGU B
 Template Sequence