Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1031
Clone ID E1031
Template ID T1031
Template Origin Plasmid
Clone Image 2087880
Validity OK
Gene symbol 1500002M01Rik
Gene description RIKEN cDNA 1500002M01 gene (1500002M01Rik)
Gene Aliases  
MGI ID MGI:1916229
Entrez Gene ID 68979
Ref Seq Accession NM_133702
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000018577
ENSEMBL Gene ID ENSMUSG00000018433
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 11
Template Well H10
Template Group  
Template Sequence Status Partial
Template Sequence ID 2087880_r1AI788146BX
TGU B
 Template Sequence