Eurexpress II Home Page
Image
 
Image
  Home > Database > Keyword Search
Image
Image Image  
  • Search by
  Keyword
  Sequence
  Anatomy
  • Partners
  EMAGE
  GenePaint
 
 
 
Image Image
 
 
 
  View Template Information

EURExpress Template ID: T1028
Clone ID E1028
Template ID T1028
Template Generating Unit B
Plate 11
Well H07
Clone image 2076855
Gene symbol  
Gene description  
Aliases  
Entrez gene ID 0
Entrez ID version  
mRNA reference sequence  
Entrez accession ID version  
ENSEMB transcript ID  
Transcript version 29
ENSEMB gene ID  
Gene version 29
Template status HOLD
Working reference  
Sequence Status  
Plasmid name pME18S-FL3
Promoter to generate antisense probe T3
Antisense promoter primer sequence AATTAACCCTCACTAAAGGGAGA
Forward and reverse primers position  
Forward and reverse primer sequences  
Sequence
 

Web page contact:
Copyright © 1994-2006. All Rights Reserved.