Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T10032
Clone ID E10032
Template ID T10032
Template Origin Plasmid
Clone Image 6762967
Validity OK
Gene symbol Wars2
Gene description Mus musculus tryptophanyl tRNA synthetase 2 (mitochondrial) (Wars2), mRNA.
Gene Aliases 5730427B17Rik, 9430020O07Rik
MGI ID MGI:1917810
Entrez Gene ID 70560
Ref Seq Accession NM_027462
Chromosome Location 3
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pDONR 201
AntiSense Promoter T7
Sense Promoter T3
Forward Primer T7-pDONR 201-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCTCGCGTTAACGCTAGCATGGAT
Reverse Primer T3-pDONR 201-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGGTGCAATGTAACATCAGAGA
Template Plate 2000
Template Well B10
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC089583
TGU M
 Template Sequence