Eurexpress II Home Page
Image
 
Image
  Home > Database > Keyword Search
Image
Image Image  
  • Search by
  Keyword
  Sequence
  Anatomy
  • Partners
  EMAGE
  GenePaint
 
 
 
Image Image
 
 
 
  View Template Information

EURExpress Template ID: T8
Clone ID E8
Template ID T8
Template Generating Unit M
Plate 1
Well A08
Clone image 791957
Gene symbol 2810013E07Rik
Gene description RIKEN cDNA 2810013E07 gene (2810013E07Rik)
Aliases AV063769, D130008D20Rik
Entrez gene ID 72656
Entrez ID version  
mRNA reference sequence NM_178112
Entrez accession ID version  
ENSEMB transcript ID ENSMUST00000044616
Transcript version 29
ENSEMB gene ID ENSMUSG00000040738
Gene version 29
Template status OK
Working reference  
Sequence Status  
Plasmid name pBluescribe (modified)
Promoter to generate antisense probe T3
Antisense promoter primer sequence AATTAACCCTCACTAAAGGGAGA
Forward and reverse primers position  
Forward and reverse primer sequences  
Sequence
TTTTTTTTTT TTTTATTATA TAAACTTAAT CTTTTAATAC TGTTTACTTT TAGCCCACTG TTTAAAAAAT AAAATTGAAA AAAATTAACT AACTGCTTAA AAGTAAAGTT TTGCCATTGC TTGTAGAAAC TTCTTTTTCC TTCTCTGTGC TGCCAGCTGT AATACTTCTT CAGGGTTGCT TGCATTCAAT TCTGTTTGGC CAATGGCTTT GATTGCAATC TGTCTTTTAT CTGTTTCTCC TCTTTTATGA TGAAGATAAG TCAAGTACTC CAAGATTGTG ACGTCCCAAA TGTAGTCATA GTAGGAATCC ATAGCGTCAT GGCTGTTTTG TTCCTGCAAT GACTTGAAGG CTGTTTTGTA GTCAATTTCT CTGAGGAACT GACATAAAAT TGCCACCTGT GTATGACAAT TCAGCAAAGA ACAGCATTTT ATCATTCGTT TTATCACTTG GTCTGTATAT ACATCAGGAG GCACAGCCTT ATTAAAGAAG TCAGAGCACA CAGCTCCTGC CTG
 

Web page contact:
Copyright © 1994-2006. All Rights Reserved.